Sentence examples for 1 zinc from inspiring English sources

Fig. 1 Zinc leaching efficiency on day 30 under different temperature (A) and mineral composition (B).

In most of studies, as shown in Fig. 1, zinc sulfide (ZnS) has been used to cover the CdSe core.

Geochemical models for formation of low-temperature Cu-Pb-Zn deposits have been proposed, based on metal fixation of H2S produced by SRB [53]. Figure 1 Zinc sulfide spherule precipitated on the surface of what may have been a bacterium.

PLS analysis showed that (1) zinc and copper concentrations at the lower trophic levels are the most important latent factors that contribute to metal accumulation in land snails; (2) cadmium and lead are the main determinants of pollution pattern in areas exposed to industrial contamination; (3) at the sites located near roads lead is the most threatfull metal for terrestrial ecosystems.

For the remaining 4, they are characterized only by their structure: 1 cytochrome P450, 1 zinc finger protein, 1 tetraspanin and 1 F-box protein (Table S12C).

Similar observations were made for CD3CO-HAD(O WTLTPLK (PON1) and CD3CO-DIVEYYnDSD(O GSHVLQGR (alpha-2-glycoprotein 1, zinc) glycopeptides as confirmed by their MS/MS data.

EDS: a1, a2 - zinc acetate; b1 - zinc sulfate; c1, c2 - zinc nitrate; d1, d2 - zinc chloride.

Twenty-one animals were distributed randomly into three groups (Table 1): group 1, zinc-aluminium-levodopa nanocomposite (ZAL 2,000 mg/kg); group 2, zinc-aluminium nanocomposite (ZA 2,000 mg/kg); group 3, vehicle control (normal saline 100 mL/kg) body weight (Table 1).

Forty animals were randomly distributed into five groups, with each group containing eight rats (Table 1): group 1, zinc-aluminium levodopa high dose (ZALH 500 mg/kg); group 2, zinc-aluminium levodopa low dose (ZALL 5 mg/kg); group 3, zinc-aluminium high dose (ZAH 500 mg/kg); group 4, zinc-aluminium low dose (ZAL 5 mg/kg); group 5, vehicle control (normal saline 100 ml/kg body weight).

C3a, C5a, C5b-9, fibrinogen, haptoglobin, neural cell adhesion molecule 2, fibulin 1, zinc-α-2-glycoprotein and b3GNT3 levels did not differ between groups.

The gene Azgp1 (alpha-2-glycoprotein 1, zinc-binding; Fw: AAGGAAAGCCAGCTTCAGAG; Rev: ACCAAACATTCCCTGAAAGG) was chosen as endogenous control since the expression arrays did not show any differences in expression of this gene between the two experimental groups (WT vs GRdim).