Sentence examples for 1 trc from inspiring English sources

Rep-accuracy and N50 were a little down but still good; when depth dropped to 2 or 1, TRC and NNC were increasing, while N50, Max, and Rep-accuracy were decreasing; meanwhile the completeness of assembled repeats is getting worse.

One of the most prominent racecars for sale is the elegant 1957 Ferrari 625 TRC Spider.

B16 TRC apoptosis by 1-MT or DMF was also observed in the presence of IFN-γ (Supplementary Fig. 5e).

Moreover, the knockdown of either PD-L1 or iNOS did not affect IFN-γ-induced B16 TRC dormancy (Supplementary Fig. 2g), suggesting that IFN-γ selectively mobilizes the IDO1 pathway to mediate TRC dormancy.

It could be considered a companion piece to the 625 TRC, in that it's generally considered among the prettiest of its age.

In addition to AhR, our data showed that IDO1 inhibitor 1-MT or IDO1 shRNAs also reduced B16 TRC colony number and size in the presence of IFN-γ (Fig. 6c,d and Supplementary Fig. 5c,d).

The psychophysical latency was given by the constant term of the equation which expressed the reaction time tR according to the inverse of the slope 1/α, tRC = 0.392+4.73/α (r902 = 0.135 p<0.0011): LψW = 0.392 (0.333–0.451) s (Fig. 5D).

Production of lentiviral particles was performed following Addgene's pLKO.1 TRC Cloning Vector Protocol (2006).

Lentiviral vectors pLKO.1 TRC and pWPI.1 were used for constructing recombinant lentiviruses.

For shRNA-mediated knockdown of DUSP6 in 32D cells, pLKO.1-based constructs were obtained from the Sigma-Aldrich (Deisenhofen, Germany) MISSION® shRNA collection: Dusp6 #1 TRC ID number TRCN0000055038 (5'CCGGCGATGCTTACGACATTGTTAACTCGAGTTAACAATGTCGTAAGCATCGTTTTTG 3'); Dusp6 #4 TRCN0000055041 5'CCGGCCTGAGGCCATTTCTTTCATACTCGAGTATGAAAGAAATGGCCTCAGGTTTTTG3'.

(Table 1) For 58 TRC clinical isolates, drug susceptibility result was available.