Sentence examples similar to 1 straddle from inspiring English sources

Similar(58)

The movies, all conceived before Sept. 11, straddle a strange line that separates New Yorkers from the recent past.

The group of port machinery operators included 85 straddle carrier drivers, 88 fork-lift truck drivers, and 46 crane operators.

But McMillan says that he would buy the July 250 straddle, paying about $13.75-$13.80 and hope for the best.

One way to take advantage of this situation is to play an Aug. 20 straddle in an effort to capture gains on a potentially volatile move in the shares.

2) Straddle The Online and Offline World - Digital marketing is great.

The primers 3R22.36f: 5′ CAGTACACAATGGTGGGCAT 3′ and 3R22.36r: 5TTTGGTCCAAAAGGAAGCTGA 3 straddle a region of a D. simulans– D. sechellia alignment that contains a 20-bp deletion in D. simulans.

You can improve your jumps by doing 10 straddle leg lifts on your right and left leg each and doing pike leg lifts.

In addition, the conduction and valence band-edges of ZnO and TiO2 just straddle H2O/H2 and OH−/O2− redox levels and thus satisfy a mandatory requirement for spontaneous photosplitting of water [10].

acceleration of vibration measured on the seatpan of port vehicles and machines averaged 0·90 m/s2 for fork-lift trucks, 0·48 m/s2 for straddle carriers, 0·53 m/s2 for mobile cranes, and 0·22 m/s2 for overhead cranes.

Mr. Lott, 61, straddles two disparate generations.

The Lady Vols' run was 26-12 over 8 40 straddling both halves.

Show more...

Your English writing platform

Write better and faster with AI suggestions while staying true to your unique style.

Student

Used by millions of students, scientific researchers, professional translators and editors from all over the world!

MitStanfordHarvardAustralian Nationa UniversityNanyangOxford

Since I tried Ludwig back in 2017, I have been constantly using it in both editing and translation. Ever since, I suggest it to my translators at ProSciEditing.

Justyna Jupowicz-Kozak quote

Justyna Jupowicz-Kozak

CEO of Professional Science Editing for Scientists @ prosciediting.com

Get started for free

Unlock your writing potential with Ludwig

Letters

Most frequent sentences: