Your English writing platform
Discover LudwigExact(4)
The dissolution rates of dolomite rock samples varied only slightly from 1.06 × 10− 07 to 2.02 × 10− 07 mol m− 2 s− 1 (SSA approximately 0.002 m2/g) in the temperature range 5 25 °C at circum-neutral pH.
As shown in Table 1, SSA mailed the vast majority of these Tickets on the IMM.
The order of treatments in group 4 was: MTX plus infliximab with increasing MTX doses from 15 to 25 mg/week, then with increasing infliximab doses as in group 1; SSA; leflunomide; MTX plus CSA plus prednisone; gold; AZA plus prednisone.
The sequences used for illustration in Figures 1, 2, 3, 4, 5, 6 are: Example 1: SSA version I, R = ' GAGCAUCCGUGUAACCAUUCACACUGCUC ' Example 2: SSA version I, R = ' GGGGGGGGGGGGAAAUCCCCCCCCCCCC ' As a possible application of biological significance, the time-dependent approach discussed above is suggested for beneficial use in the problem of deleterious mutation prediction.
Similar(56)
2eb584ce-ed13-4b33-b0f9-1860fb51f7c8 SUB-SAHARAN Africa (SSA) can be a great place to do business.
We expect 2D-SSA and shaped SSA to therefore have broad applicability to image processing in developmental biology.
Higher amounts of SSA had an even more drastic effect on the growth of ssadh-3 (SSA 1.5 and 2 mM; Figure 6A).
This was achieved by analysing data drawn from 46 SSA countries.
The SSA projects that it could lose a third of its workforce by 2020, when more than 30,000 SSA workers become eligible for retirement.
Figure 11 SSA results.
About six to 10 SSA master's students and counterparts from the Tata Institute participate each year.
Write better and faster with AI suggestions while staying true to your unique style.
Since I tried Ludwig back in 2017, I have been constantly using it in both editing and translation. Ever since, I suggest it to my translators at ProSciEditing.

Justyna Jupowicz-Kozak
CEO of Professional Science Editing for Scientists @ prosciediting.com