Sentence examples for 1 sense from inspiring English sources
Open image in new window Fig. 1 Sense and denotation according to Frege's view.
The rainbow smelt sequence was obtained using primers #1 sense and antisense.
As control, the exon 1 sense and exon 5 antisense primers amplified the expected size product using testis mRNA from wild type and Sacytm1Lex/+ heterozygous mice (Fig. 6).
Briefly, two fragments of the VEGF 3'-UTR with multiple MREs were PCR-amplified using primers with the following sequences: construct 1 sense, 5'-cgttctagagtttcgggaaccagatctc; antisense, 5'-aacactagtaatgcttccgccggagt; construct 2 sense, 5'-tcttctagacaggtcagacggacag; antisense, 5'-acaactagtctcttctcttcgccgg.
They are numbered sequentially from outermost to innermost; #1 sense 5'-CAGCCTGTGAAGGTGCGTGTGTC-3', #2 sense 5'-TTCCGCTCTTTCAAGGCCACCAA-3', #3 sense 5'-GGCATGTACCGCTACAAGTACAA-3', #1 antisense 5'-CTTCCAAGGAATGTTGGCCTTCCA-3', #2 antisense 5'-CCGTGTTGGTCCACCAGTCAGCTTT-3', #3 antisense 5'-GAGATGCTTCAGGTCTTTGCACAT-3'.
After digestion with MmeI, an enzyme that recognizes the junction of the Illumina adaptor 1 (sense: 5'andCtheTTCATGACACGACGCTCTTCCGATC3') and the CATG site, 21 bp tags containing the adaptor 1 sequence were produced.
For example, for the structural component of the COVE index output by tRNAscan-SE estimating the cloverleaf formation (see corresponding columns in Table 1), sense-antisense COVEs correlate positively (r = 0.397, one tailed P = 0.037).
Pair 1 siRNAs (PINK1 #1; sense strands: GGACGCUGUUCCUCGUUAU and AAGCCACCAUGCCUACAUUUU) were designed and synthesized by Dharmacon.
The following shRNA sequences specific for human Bid mRNA were designed using the Dharmacon siRNA design tool (http://www.dharmacon.com/sidesign/): Bid-1 sense (5'-AAGCTGTTCTGACAACAGC-3'), Bid-2 sense (5'-AAGGAGAAGACCATGCTGG-3') and Bid-3 sense (5'-AAGAATAGAGGCAGATTCT-3').
The primers chosen were as follows: NRP-1 sense, 3′-ACGATGAATGTGGCGATACT-5′; antisense, 5′-AGTGCATTCAAGGCTGTTGG-3′.
Primers for HBD-1 sense, 5'-ATGAGAACTTCCTACCTTCTGCT-3', and HBD-1 antisense, 5'-CTCTGTAACAGGTGCC-3', resulted in a 184-bp fragment.
