Sentence examples for 1 primer from inspiring English sources

12284_2014_2_MOESM1_ESM.xlsx Additional file 1: Primer sequences of markers developed for the genetic analysis.

The LSSP-PCR profiles obtained with the Internal 1 primer or with the G1 primer allowed the grouping of the leptospires into serogroups.

The primers utilized are shown in Fig. 1 Primer pairs were designed using the Primer Quest tool found on the Integrated DNA Technologies-ITD website, (http://www.idtdna.com/site).

Table 1 Primer sequences and probes designed in the study Primer Sequence (5′ → 3′) Genomic position Product length (bp) F1 R1 CGGAATTCAGTCCGCGAAGAAGTTTTTG CCCTCGAGGCGAGTCCGAGAAGAATACG 125 622 514 F2 R2 GGGCTCTACTCCACCAACAA CGAGTCCGAGAAGAATACGC 442 621 180.

Primer AP1 (Table 1: Primer AP1) was used as the antisense primer for all three approaches.

These were SAG 1 (primer sequences 5'-CGACAGCCGCGGTCATTCTC-3' and 5'-CGACAGCCGCGGTCATTCTC-3') (28), SAG 4, (primer sequences 5'-TGGACCTACGATTTCAAGAAGGC-3' and 5'-GCTGCGAGCTCGACGGGCTCATC-3') (29) and BAG 1 (primer sequences 5'-TCCGCCGGGAGCTTGTCCACC-3' and 5'-GCAAGTCAGCCAAAATAATCA-3') (30).

By using the CTX group 1 primer-pair, none of the inserts were found by blastx search to contain the gene encoding the CTX-type β-lactamase.

PCR was done with a Tm of 56 °C for the BH4-M22 primer set and 57 °C for the Rc-1 primer set.

PCR amplicons were sequenced by using the P1 1 primer.

hsf-1 primer set 1: forward: TTGACGACGACAAGCTTCCAGT; reverse: AAAGCTTGCACCAGAATCATCCC. hsf-1 primer set 2: forward: GTCTCTGTCATGCAGCCAGG; reverse: TTGGGTCCGGCAGTTCC.

The Mtg-1 primer annealed only to the longer ~1.1 kb transcript.