YP_001001278) was amplified from genomic DNA using the primers MO608 (5′-AATT CATATGCAAGGGAAAATGATGAAAAA -3′) and MO612 (5′- GTA GGATCCAATTTCAATCTCGTACCAAAGGTAT -3′) (Table 3) (NdeI and BamHI sites, respectively, are underlined).
Grand Theft Auto 5 (GTA 5) is one such game.
E3 2014: Sony hits with Uncharted 4, GTA 5 and Grim Fandango Microsoft at E3 2014: from Halo 5 to the return of Crackdown - the key points.
PlayStation and Xbox bosses discuss the future: 'We made the right call' E3 2014: hands-on with the key PlayStation 4 titles E3 2014: Sony hits with Uncharted 4, GTA 5 and Grim Fandango.
Although it was quickly knocked off the top of the videogame charts by Fifa 14, GTA 5 is still posting record sales and has already sold more copies in the UK than GTA 4 has to date.
GTA: Vice City captured the sleazy glam of the 80s, GTA: San Andreas focused on black culture of 90s Los Angeles and Grand Theft Auto V provided a modern satire on modern day LA, but all referenced real locations, people, events and companies to add edge and authenticity.
OK, but even if we're right, you still don't get the choice of a sweet, new $19,000 Alfa Romeo 156 GTA, do you?
If you're ever played the PS2 GTA games on the PC, then you know just how big an improvement the PC version is over the console one.
A man of few words, Keef simply told us "Call of Duty, NBA 2K, GTA".
