Sentence examples similar to 1 gac from inspiring English sources

Similar(60)

Finally, in the comparison with the state-of-the-art uniform deblurring methods [9, 21, 24, 43], slice GAC with GS-GAC is adopted.

Figure 6 shows the removal efficiency of PCP from aqueous solution by COP, SOP and single GAC (adsorption) process under the same conditions (PCP concentration, pH 8, and 8.33 GAC−1 GAC dosage).

Compared with the model in [30, 33], GAC can achieve much better tradeoff between memory and computational complexity.

Fig. 11 GAC exhaustion profile in the rum filter based on the spatial concentration analysis of X-ray radiography digital image processing.

Polymerase chain reaction on the streptococcal DNA with the primers Eno1 (GAC TCA CGC GGT AAC CCA AC) and Eno2 (ATT GTT GAA TCT TCA GTT TCA CC) produced 1.1 kb amplicons of internal coding sequence.

Some of them corresponded to silent mutations (GTC to GTT at V74; ATC to ATT at I65; GAC to GAT at D39, and TGA to TAA at the stop codon of the gene).

For V5 tagging (pHD1911), the plasmid used was from [16] and the primers were: ORF cz2992 (gac ctcgagATGCCAAAAATGCGTTTAGA), cz2991 (gac gggcccGCCAAGGTAAGGGAGGAAAC); 5′-UTR cz2994 (gac ccgcggGAGTGGTGGCCTTCATTCAC), cz2993 (gac tctagaTGCTCCCTTTAGTTCACTTCAA).

The codons involved were 94 (gac D94A gcc, n = 7; gac D94G ggc, n = 5) and 90 (gcg A90V gtg, n = 2) (table 2).

Our TMAs contained 73 GAC specimens and 10 adjacent non-tumour tissue specimens (Table 1).

Consistent with previous reports, the most common mutations were 12 GAT, 12 GTT and 13 GAC [ 1, 2].

The primer KRAS-PF3 (5′-TGGTAGTTGGAGCTGGT-3′; pyrosequenucleotideeotidispensationiorderder, GATGCATGCATGCATGCATGCATGCATGC) could detect the c.34G>A (codon 13 GAC) mutation.

Show more...

Your English writing platform

Write better and faster with AI suggestions while staying true to your unique style.

Student

Used by millions of students, scientific researchers, professional translators and editors from all over the world!

MitStanfordHarvardAustralian Nationa UniversityNanyangOxford

Since I tried Ludwig back in 2017, I have been constantly using it in both editing and translation. Ever since, I suggest it to my translators at ProSciEditing.

Justyna Jupowicz-Kozak quote

Justyna Jupowicz-Kozak

CEO of Professional Science Editing for Scientists @ prosciediting.com

Get started for free

Unlock your writing potential with Ludwig

Letters

Most frequent sentences: