The IDC 2016 CMO FutureScape predicts CMO turnover continuing at 25percentt per year or higher through 2018.
Asked how what Jumio has built for mobile web differs from what Apple is introducing in iOS 8, CMO Marc Barach could tick off a number of advantages.
Carbon co-founder and CEO Dr. Joseph DeSimone (winner of the $500K Lemelson-MIT prize in 2008) and Adidas Executive Board Member (global brands) Eric Liedtke (named 2017 CMO of the year in Germany) will join us on stage to discuss a range of topics, from upending traditional manufacturing to the relationship between incumbents and disruptive startups.
The Fortune 500 CMO says the secret sauce is in sharing: ideas, conversations, even company secrets.
hdMO1, hdMO2, cMO and mcMO1 morpholinos were prepared and injected in the manner described in ref. (18).
The data in PhenoMiner are organized by four ontologies: RS (9), CMO, MMO and XCO (10, 11).
For abca12 knockdown: splice donor site morpholino (MO1), tgggaaataaatgtaatttacctgt, targets the exon-4 intron-4 junction, AAATGAAATAACTGA[ACAGgta-aattacatttatttccca]acggtc; 5-basexon-4 intron-4ed control morpholino for abca12 (cMO): tgg caaa aaaat ctaatttac gt ct.
However, a few macropores are detected in samples CMO-1, CMO-4, and CMO-24.
The final products were marked as CMO-1, CMO-4, CMO-8, CMO-12, and CMO-24, respectively.
The structural studies of the complex formed between 10G6D6 and 6-CMO-estradiol have identified contacts between the 6-CMO coupling linker and an arginine residue from the heavy chain CDR2 segment.
The hottest standalone category to date has been marketing automation, which has become a "must have" solution for B2B CMOs.
