Sentence examples for 1 catalogue from inspiring English sources

AIP5 On-Target smartpool siRNA, used in a pool containing 4 oligonucleotides (GGUCUGAUACUAGUAAUAA, GAACGCGGCUUUAGGUGGA, GAAAAGCAACGAUAGAUUU and CCAGAUGGAUUGAAGAGUU, catalogue numbers J-004251-07 to -10) and non-targeting control siRNA (#1, catalogue number D-001210-01) were obtained from Dharmacon.

Non-targeting control siRNA (1, catalogue number D-001210-01) was obtained from Dharmacon, Inc. SiRNA directed against clathrin heavy chain had the sequence UAAUCCAAUUCGAAGACCAAU, obtained from Motley et al. (46).

Table 1 catalogues the outbreaks used in this study.

RNA-mediated interference for downregulating TLR4 and TLR2 was done by the transfection of TLR4 siRNA (catalogue #HSS110818) or TLR2 siRNA (catalogue #HSS110813) purchased from Invitrogen.

11557; (516) 374-2522; catalogue, $2. Ironweed and switch grass: Sunlight Gardens, 174 Golden Lane, Andersonville, Tenn.

And there's plenty of garage space in the PS4 catalogue for that.

Nelson Bible Group's 2006 catalogue lists more than a hundred titles.

In 1946 the Bibliographic Society of London decided to enlarge & revise the 1475-1640 catalogue.

It's not the first time in recent years that Elton John has returned to his early 70s catalogue.

"Last year, Citizens Advice helped with nearly 55,000 catalogue and mail order debt issues, with many people struggling to keep up repayments.

Steve Hackett, former Genesis guitarist, has just released his third album revisiting the progressive rockers' classic 70s catalogue.