When kidney graft survival analysis was stratified for anti-HLA antibodies presence and their specificities, they found that both donor-specific (49%) and non-donor-specific antibodies (70%) were associated with worse graft survival than antibody-negative patients (83%).
EL analyzed the results of these blast searches to identify various group-specific proteins and confirmed their specificities by means of PSI-blast and genomic blasts.
Gene-specific primers were designed using Primer 5.0, and their specificities were checked by the melting curves of the RT-PCR products.
The primers were: LMW-i-F: TGAAGACCTTCCTCGTCTTTG, LMW-i-R: CTGTGAAATTTGCGCAACG. Gene-specific primers were designed using Primer 5.0 and their specificities were checked by the melting curves of the RT-PCR products.
Event-specific primers targeting the eight GM canola events were designed, and their specificities were confirmed using 14 GM events of maize, soybean, cotton, and canola.
Furthermore, it is unclear how SFN treatment leads to selective de-methylation of specific CpG sites, but SFN may indirectly affect regulations of DNMTs and their specificities toward certain CpG sites.
By contrast, Quentin Tarantino displays admirable chutzpah in his use of pop songs without necessarily plumbing their specificities (any bouncy strut would have done for the torture scene in "Reservoir Dogs," but "Stuck in the Middle with You" is stuck with it until someone else uses it better).
The following subsections describe these subspaces and their specificities.
Therefore, this intervention should be conducted considering their specificities and the significant differences found.
A preliminary study of cloth characteristics, including scanning electron micrographs, shows their specificities towards particular media.
It cannot be used to segment Arabic or Chinese handwritings due to their specificities, unless a deep modification.
